Converting Cubic Centimeters to Liters Example Problem

This example problem demonstrates how to convert cubic centimeters to liters (cm3 to l). Cubic centimeters and liters are two metric units of volume. Cubic Centimeters To Liters Problem What is the volume in liters of a cube with sides of 25 centimeters? Solution First, find the volume of the cube.**Note** Volume of a cube (length of side)3Volume in cm3 (25 cm)3Volume in cm3 15625 cm3 Second, convert cm3 to ml1 cm3 1 mlVolume in ml Volume in cm3Volume in ml 15625 ml Third, convert ml to L1 L 1000 ml Set up the conversion to cancel out the desired unit. In this case, we want L to be the remaining unit. volume in L (volume in ml) x (1 L/1000 ml)volume in L (15625/1000) Lvolume in L 15.625 L Answer ï » ¿A cube with 25 cm sides contains 15.625 L of volume. Simple cm3 to L Conversion Example If youre lucky enough to have the original value already in cubic centimeters, conversion to liters is easy. Convert 442.5 cubic centimeters into liters. From the previous example, you should realize a cubic centimeter is the same volume as a milliliter, so: 442.5 cm3 442.5 ml From there, you just need to convert cm3 to liters. 1000 ml 1 L Finally, convert the units. The trick is to check the set-up of the conversion to make sure the ml units cancel out, leaving you with liters for the answer: volume in L (volume in ml) x (1 L/1000 ml)volume in L 442.5 ml x (1 L/1000 ml)volume in L 0.4425 L Note: Whenever a volume (or any reported value) is less than 1, always add the leading zero before the decimal point to make the answer easier to read.

Cross Cultural Differences Between The United States,...

Michael Dennis Soc 210 Introduction to Sociology 5H02FA Cross Cultural Differences in Education Education plays an important role in our everyday lives. It allows us to have the knowledge and capabilities to perform tasks and overcome challenges in a variety of situations. Education is the process of acquiring knowledge, skills, beliefs, or values. These attributes that are acquired in education helps to get into college, start a career, or can even understand people. Within this research paper I will be examining the cross-cultural differences in education between the United States, Finland, and South Korea. Education within the United States The United States education system operates by the state. Each state contains school districts which jobs are to â€Å"coordinate education policies, planning for changing educational needs within the community, and often even establishing programs curricula† (Corsi-Bunker 2). Public schools also rely heavily on local taxes to fund their educational needs, thus creating the community and financial status to reflect how the school performs and what they teach. Therefore, with individual districts within the state that regulate their own education within their schools, there is a variation among courses, subjects, and other activities. The education levels in the United States vary but all follow about the same path. Usually, the education system goes from elementary school (grades k-5), middle school (grades 6-8), and high school (gradesShow MoreRelatedEssay about Values Based Decision-Making1416 Words   |  6 PagesAn individuals personal, organizational, and cultural values are the foundation of their personal and professional decision-making cycle. These values form the core of that individuals moral fabric, and his actions and decisions are predicated on those beliefs. Shalom H. Schwartz defined values as conceptions of the desirable that guide the way social actors (e.g. organizational leaders, policy-makers, individual persons) select actions, evaluate people and events, and explain their actions andRead MoreValues Based Decision-Making Essay1372 Words   |  6 PagesAn individuals personal, organizational, and cultural values are the foundation of their personal and professional decision-making cycle. These values form the core of that individuals moral fabric, and his actions and decisions are predicated on those beliefs. Shalom H. Schwartz defined values as conceptions of the desirable that guide the way social actors (e.g. organizational leaders, policy-makers, individual persons) select actions, evaluate pe ople and events, and explain their actions andRead MoreHofstede’s Limitations14637 Words   |  59 PagesImproving Cultural Indices 1 IMPROVING CULTURAL INDICES AND RANKINGS BASED ON A METAANALYSIS OF HOFSTEDE’S DIMENSIONS VAS TARAS University of Calgary Haskayne School of Business SH441, Human Resources and Organizational Development 2500 University Drive NW Calgary, Alberta, Canada T2N 1N4 Tel: (403) 220-6074 Fax: (403) 282-0095 e-mail:taras@ucalgary.ca PIERS STEEL University of Calgary Haskayne School of Business Human Resources and Organizational Development SH444 - 2500 University DriveRead MoreMajor Differences Between Us Gaap And Ifrs2062 Words   |  9 PagesMAJOR DIFFERENCES BETWEEN US GAAP AND IFRS Student’s name: University: Date of submission: PART I a) History of the convergence project between US GAAP and IFRS The US Generally Accepted Accounting Principles (GAAP) is a set of international accounting rules which originated from the United StatesRead MoreBusiness and Culture3340 Words   |  14 PagesAlthough variations can be seen between or among different groups, it can also exist within a group. More often, we associate culture with a larger group such as a country, yet culture also exists in ethnic groups, tribes, and organizations. We often refer to them as a subculture. Dealing with a group of people from another culture or ethnicity is what we commonly refer to as cross-culture. Cross-culture binds together fields which are not quite related such as cultural anthropology and communicationRead MoreHofstede’s Cultural Dimensions Us vs. India Essay2489 Words   |  10 PagesHofstede’s theory of cultural dimensions, and defines five of them for a comparison between the United States and India. This article shows for the most part, the definitions of Hofstede’s cultural dimensions are correct, but the article did identify some ambiguities while making the comparisons. Finally, future areas of possible research were identified that would assist in the removal of the ambiguities. Hofstede’s Cultural Dimensions US vs. India Geert Hofstede’s theory of cultural dimensions wasRead MoreDifferent Approaches to Corporate Reporting Regulation22097 Words   |  89 PagesDifferent approaches to corporate reporting regulation: How jurisdictions differ and why Christian Leuz a a b c d J. Sondheimer Professor of International Economics, Finance and Accounting, University of Chicago Booth School of Business, 5807 South Woodlawn Avenue, Chicago, IL, 60637–1610, USA E-mail: b c d Research associate at the National Bureau of Economic Research, Cambridge, MA European Corporate Governance Institute, Brussels Fellow of the Wharton Financial Institutions Center,Read MoreThe Future of Globalization5305 Words   |  22 Pagesthrough the increasing volume and a variety of cross-border transactions in goods and services and of international capital flows and also through the more rapid and widespread diffusion of technology†. Thomas Freeman, author of â€Å"The Lexus and the Olive Tree† describes Globalization as the inexorable integration of markets, nation states and technologies to a degree never witnessed before in a way that is enabling individuals, corporations and nation states to reach around the world, farther, fasterRead MoreComparison Between Japan and Russia13811 Words   |  56 PagesCultural differences A comparison of Russia and Japan Kristina Aksakova Exchange student Virrat, 2011 [pic][pic] Table of contents General information about Russia and Japan 4 Japan 4 Background 4 Tsunami Devastates Japan 5 History 6 Geographical facts 8 Demographical facts 9 Economic facts 11 FOREIGN RELATIONS 13 Governmental facts 15 Infrastructural facts 16 Russia 18 Background 18 History 18 Geographical factsRead MoreAre Protectionist Policies Beneficiak to Business? Essay10942 Words   |  44 Pagessuch as tariffs (taxes on imported goods), quotas (limits on the amount of goods that can be imported), subsidies (government support of certain domestic businesses or industries), and other policies like the â€Å"Buy American† requirements in the United States. Let’s take a look at a couple of broad examples. When foreign competitors in a particular industry operate with a lower cost basis, home governments will frequently provide funds (subsidies) to that industry in their own country I 345

Reflection on IT around US-Free-Samples for Students-Myassignment

Question: Write a Reflection on IT around Us. Answer: Google Search Engine, Wearable, and Smartphone are the three common IoT devices that we usually interact with in a single day. Google Search Engine Functionality: It presents relevant options searched by the keywords and present relevant options after doing calculation based on machine learning. Usage: There are various applications of Googles search engines such as search discussion groups, search law blogs, use academic specific search engines, find information from websites, search news, search images and many more. Wearable Functionality: Wearable are the trending technology that is beneficial in tracking information related to the fitness and health of the individual (Sun, Liu and Zhang 2017). Usage: Google glass is a revolutionary technology that is enabling doctors in recommending actual data feedback through voice recommendations, Fitbit watches are helpful in tracking heart rate, listening music, connecting to internet and many more. Smartphone Functionality: It has become an integral part of the life of individuals. It allows users to use various applications via connecting to internet that is much advance than calling and message (Khan, Shahzad and Hassan 2017). Usage: Mobile devices can enable the exchange of data or information via connecting to the internet and connect to the world. Cloud storage, access to mails and messages, entertainment, official apps for the official purpose, education application, and many more are some of the vital application of Smartphones. References Khan, U., Shahzad, M.U. and Hassan, A., 2017. Internet of Things (IoTs): Appl. Sun, W., Liu, J. and Zhang, H., 2017. When smart wearables meet intelligent vehicles: challenges and future directions.IEEE wireless communications,24(3), pp.58-65.

Phenylalanine hydroxylase (PAH) Gene Essay Example

Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000  µmol compared to the normal 100  µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600  µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as â€Å"mousy†, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the â€Å"Location† link on the PAH listing. The website lists the location of the gene to be at â€Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.†(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading â€Å"Cyto† (for cytogenic) and stated as â€Å"12q22-q24.2† (10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the â€Å"Genes on Sequence† and â€Å"Phenotype† maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link â€Å"sv† led to a page with the title â€Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.† Searching for the gene gives the following (zoomed-in and cropped) structure:   Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under â€Å"ensRNA†:   Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12)   Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: http://www.ensembl.org/index.html. 4. [26/08/10]; Available from: http://www.genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: http://www.pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.   [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: http://www.ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [updated 21/09/09]; Available from: http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃ…LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gà ¡mez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà ­nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGO  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚     seq LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  369  Ã‚   20  Ã‚   59.83  Ã‚   55.00   6.00   2.00   Ã‚  TCCTCCCTAGTGCGAGGTTA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00   Ã‚  CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  Ã‚  Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  339  Ã‚   20  Ã‚   59.77  Ã‚   50.00   Ã‚  3.00   Ã‚  1.00  Ã‚  Ã‚     ACGCAAGAGACACCCTTTGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   Ã‚  3.00   Ã‚  2.00   Ã‚  Ã‚  Ã‚  Ã‚  CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   318  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   522  Ã‚   20  Ã‚   59.98  Ã‚   55.00   3.00   2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   157  Ã‚   20  Ã‚   60.07  Ã‚   55.00   2.00   0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   156  Ã‚   20  Ã‚   60.07  Ã‚   55.00   3.00   0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   337  Ã‚   20  Ã‚   59.32  Ã‚   55.00   4.00   3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left  Ã‚  Ã‚   3637  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   162  Ã‚  Ã‚  Ã‚   0  Ã‚   419   2558  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚   22  Ã‚  Ã‚   73  Ã‚   401 Right  Ã‚   3701  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   130  Ã‚  Ã‚  Ã‚   0  Ã‚   321   2817  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   2  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   78  Ã‚   353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start   Ã‚  len   Ã‚  Ã‚  tm   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  gc%   Ã‚  any     Ã‚  3  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     seq 1 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00  Ã‚     GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   260  Ã‚   22  Ã‚   60.05  Ã‚   40.91   4.00   0.00   Ã‚  GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   45  Ã‚   20  Ã‚   60.39  Ã‚   50.00   6.00   1.00  Ã‚     AGCCATGGACAGAATGTGGT RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   265  Ã‚   20  Ã‚   58.12  Ã‚   40.00   3.00   0.00   Ã‚  TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   19  Ã‚   20  Ã‚   60.21  Ã‚   50.00   5.00   2.00   Ã‚  Ã‚  Ã‚  GCAGTGCCCTCCAGAAAATA RIGHT PRIMER  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   258  Ã‚   20  Ã‚   57.92  Ã‚   40.00   4.00   0.00   Ã‚  TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics con  Ã‚   too  Ã‚  Ã‚   in  Ã‚  Ã‚   in  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   no  Ã‚  Ã‚   tm  Ã‚  Ã‚   tm   high   high  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   high sid   many  Ã‚   tar   excl  Ã‚   bad  Ã‚  Ã‚   GC  Ã‚   too  Ã‚   too  Ã‚   any  Ã‚  Ã‚   3   poly  Ã‚   end ered  Ã‚  Ã‚   Ns  Ã‚   get  Ã‚   reg  Ã‚   GC% clamp  Ã‚   low   high compl compl  Ã‚  Ã‚  Ã‚   X   stab  Ã‚  Ã‚   ok Left     Ã‚  7708  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚   791  Ã‚  Ã‚  Ã‚   0   4562  Ã‚   600  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   14  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   52   1689 Right  Ã‚   7734  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   0   1269  Ã‚  Ã‚  Ã‚   0   4609  Ã‚   311  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚  Ã‚   6  Ã‚  Ã‚  Ã‚   0  Ã‚  Ã‚   44   1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4

Origins of the Kettlebell. Strength and Cardio Training

Origins of the Kettlebell. Strength and Cardio Training The kettlebell is a peculiar piece of gym equipment. While it looks like a cannonball with a looping handle protruding at the top, it can  easily be mistaken for an ironcast tea kettle on steroids. It also happens to be growing in popularity, allowing athletes and those just trying to stay in shape to perform a wide range of specialized strength-building exercises with kettlebells. Born in Russia It’s hard to say who invented the kettlebell, though variations of the concept go as far back as Ancient Greece. Theres even a 315-pound kettlebell with the inscription  Ã¢â‚¬Å"Bibon heaved up me above a head by one head on display at the Archaeological Museum of Olympia in Athens. The first mention of the term, however, shows up in a Russian dictionary published in 1704 as Girya, which translates to kettlebell in English. Kettlebell exercises were later popularized in the late 1800s by a Russian physician named Vladislav Kraevsky, considered by many to be the countrys founding father of Olympic weight training. After spending roughly a decade traveling around the world researching exercise techniques, he opened one of Russias first weight training facilities where kettlebells and barbells were introduced as a core part of a comprehensive fitness routine. By the early 1900s, Olympic weightlifters in Russia were using kettlebells to shore up weaker areas, while soldiers used them to improve their conditioning in preparation in combat. But it wasnt until 1981 that the government finally threw its weight behind the trend and mandated kettlebell training for all citizens as a way to boost overall health and productivity.  In 1985, the Soviet Unions first national championship kettlebell games were held in Lipetsk, Russia. In the United States, it’s only as recent as the beginning of the century that kettlebell has caught on, particularly in the last few years. A-list celebrities such as Matthew McConaughey, Jessica Biel, Sylvester Stallone, and Vanessa Hudgens have been known to utilize kettlebell workouts to strengthen and tone. There’s even an all-kettlebell gym located in Ontario, Canada, called the IronCore Kettlebell club. Kettlebells vs. Barbells What distinguishes a kettlebell workout from training with barbells is an emphasis on a wider range of movement that involves several muscle groups. Whereas barbells are generally used to directly target isolated muscle groups, such as the biceps, the kettlebell’s weight is away from the hand, allowing for swinging moves and other full body exercises. Case in point, here’s a few kettlebell exercises aimed at cardiovascular and strength improvement: High Pull: Similar to a squat, the kettlebell is lifted from the floor and brought up toward the shoulder level with one hand while straightening out to a standing position and returning back to the floor. Alternating between both arms, this move hits the shoulders, arms, buttocks, and hamstrings.Lunge Press: Holding the kettlebell in front of the chest with both hands, lunge forward and lift the weight over your head. Alternating each leg, this allows you to target the shoulders, back, arms, abs, buttocks, and legs.  Russian Swing: Standing with knees slightly bent and feet apart, hold the kettlebell just below the groin with both hands and with both arms straight. Lowering and driving the hips back, thrust the hips forward and swing the weight forward up to shoulder level before letting the weight swing back down to the original position. This move targets the shoulders, back, hips, glutes, and legs.  Ã‚   Additionally, kettlebell exercises burn more calories than conventional weightlifting exercises, up 20 calories a minute, according to a study by the American Council on Exercise (ACE). This is roughly the same amount of burn youd get from a rigorous cardio workout. Despite the benefits, the one drawback is that only select gyms carry them. So where can you go to find kettlebell equipment outside of obvious places like the IronCore gym? Fortunately, an increasing number of boutique gyms have them, along with kettlebell classes. Also, since theyre compact, portable and with many shops selling them for prices comparable to the cost of barbells, it might be worth it to just buy a set. Source Beltz, Nick M.S. ACE Sponsored Research Study: Kettlebells Kick Butt. Dustin Erbes, M.S., John P. Porcari, et al., American Council on Exercise, April 2013.

Early Childhood Learning Essay Example | Topics and Well Written Essays - 1500 words

Early Childhood Learning - Essay Example The third part will summarize some of the commentaries on the controversy and finally the conclusion will discuss which if any view is correct, and the importance of the controversy at hand. In an experiment conducted by Booth and Waxman (2002), a group of three years old children were subject to the same objects which were separated into two groups, either as animate objects or artifacts. When some of the objects with eyes on them, which are strong perceptual cues to animacy, and the objects were presented as artifacts, the children characterized them as artifacts. This shows that even in the face of strong perceptual gestures, conceptual information still aids the process of word learning in childhood, a view that contradicts the Attentional Learning Account view. Something which sparked a number of responses and different interpretations to this experiment but which face certain difficulties that further support the view that conceptual information does have a role in early word learning. First it was noted that both conc... s, in what sense then is perceptual information immune to conceptual information This simply means that if two factors affect the same variable, the only way one of the factors can be immune to the other is if one of them does not have an effect at all on the variable, something that the experiment mentioned above excludes. Second it was claimed by the Attentional Learning Account that perceptual information contributes directly to word learning unaided by any conceptual information; the experiment shows however that perceptual learning can be aided by conceptual information in a way that can change the outcome of the experiment. A special case of these two different views will be taken into account; namely the disagreement about the shape bias. The controversy over the role of conceptual learning in early word learning for children has initiated the shape bias controversy; briefly stated it is an implication of the two views outlined above. On the one hand the proponents of the Attentional Learning Account claim that shape bias does not emerge until infants are able to distinguish at least 50 nouns which is in line with the claim they support that conceptual knowledge is only available much later. On the other hand Booth and Waxman have shown with an experiment they conducted with 18 to 22 months old children with vocabulary that does not exceed 18 nouns that these children have extended their uses of words on the basis of shape. This experiment thus interpreted challenges the whole of the Attentional Learning Account proponents. In a paper in the Developmental Science journal, Booth and Waxman have shown experiments in support of the Attentional Learning Account view and have tried to show that they can be interpreted in a way that does not do any harm to their view

Interest Rates Essay Example | Topics and Well Written Essays - 500 words

Interest Rates - Essay Example Thirdly and lastly, the lender has to be compensated for the decrease in value of the money due to inflation, for example a dozen eggs might cost 100rs today and after a year they might cost 110rs, so if I have loaned any one 100rs I will want 110rs back because that is what 100rs is NOW worth or that is the equivalent value. There are basically two theories that explain how interest rates are decided upon, one is the 'Loanable Funds Theory' also known as the classical theory and the other one is 'Keynesian Theory' also known as the liquidity preference theory. The loanable funds theory is the older one of the two theories and according to this theory the interest rates are determined by the demand for loanable funds by firms and the supply of these funds by the banking and other investment funds, it suggests that interest rates are determined in the same way as demand for other goods and services is determined i.e. by finding the equilibrium position of the demand and supply of the relative product.