Sunday, April 19, 2020
Phenylalanine hydroxylase (PAH) Gene Essay Example
Phenylalanine hydroxylase (PAH) Gene Paper Phenylalanine hydroxylase (PAH) Gene Background: We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Phenylalanine hydroxylase (PAH) Gene specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Phenylalanine hydroxylase (PAH) encodes the liver-secreted enzyme of the same name, a catalyst for the hydroxylation of tyrosine from phenylalanine, a rate-limiting step in the catabolism of the latter. This reaction only occurs in the presence of the cofactor tetrahydrobiopterin (BH4) as well as molecular oxygen and iron (1). Mutations in the PAH gene are generally caused by a change of an amino acid, for example, the change of arginine to tryptophan (2, 3). The numerous possible mutations in this gene result in a lack of enzyme activity. Thus, because of its main function, the deficiency in the activity of PAH causes a marked intolerance of the consumption of phenylalanine, an essential amino acid. This causes phenylketonuria (PKU), non-phenylketonuria hyperphenylalaninemia (non-PKU HPA), mild hyperphenylalaninemia (MHP), and other variant PKU (4, 5, 6). Defects in the PAH gene leads to the deficiency or the disruption of the production of the PAH enzyme; this is most commonly related to the resulting disorder, phenylketonuria. PKU is an autosomal, inborn, recessive disorder of phenylalanine metabolism (7). There are three common types of PKU. First, there is classical PKU, caused by the mutation of both alleles of the PAH gene in chromosome 12 which results in a severe deficiency or complete absence of the PAH enzyme, leading to toxic levels of unhydroxylated phenylalanine, typically over 10 times higher than normal concentrations (i.e. over 1000 à µmol compared to the normal 100 à µmol). Next, there is MHP, the mildest form of the PAH enzyme deficiency, with phenylalanine levels below 600 à µmol but above normal. Thirdly, there is non-PKU HPA, caused by mutations in the PAH locus that hinder BH4 synthesis and regeneration. This relatively milder form of the disorder often results in heterozygous cases through a combination of mi ld and severe mutations (4, 7, 8). Severe classical PKU, if left untreated, is commonly known to result in the impedance of postnatal cognitive development causing mental retardation and in metabolic abnormalities causing increased phenylalanine in in the blood circulation and phenylpyruvic acid in the urine. PKU has also been known to cause skin abnormalities, organ damage, different kinds of posture peculiarities, pregnancy problems (maternal PKU), an odor describe as ââ¬Å"mousyâ⬠, as well as other mental issues such as epilepsy, hyperactivity, and psychotic episodes (1,4,7,8). The most common negative effect associated with PKU, mental retardation, is caused by a neurotoxic effect of HPA. And while PKU is an inherited disorder, its negative effects could also be induced in the offspring of mothers with PKU, resulting not only in high fetus mortality rates but also in a high probability that the children are born with growth and mental retardations as well as malformations. This is known as PKU embryofetopath y or maternal PKU syndrome (8). Conversely, children born with non-PKU HPA and MHP have marked lower risks of being affect with the adverse effects of the disorder and can have normal development mentally and physically even with the absence of treatment (4,8). Despite the severe potential effects of classical PKU, newborn screening for high levels of phenylalanine has helped early diagnosis of the disorder, which is then followed by rapid treatment. Dietary restrictions of phenylalanine has been used for early treatment of PKU which, while not necessarily lead to complete normalization of IQ, was shown to be predictive of overall IQ with the complete lack of treatment in classical PKU patients leading to severe and irreversible cognitive retardation.(1,8) Thus, primary screening of neonates and children as well as awareness of the disorder for the parents are essential (3, 6). Results and Discussion: PAH chromosomal map position and nearby genes: The location of the PAH gene is at chromosome 12. Its long arm (q) is comprised of 13 exons with an approximate length of 90 kb. Figure 1 Chromosome 12 (9) Figure 1, above, is a representation of the entire chromosome 12 with both its short arm (p) and long arm (q) as it appears in the Ensembl website, albeit cropped to fit the page. This figure can be found by searching for the PAH gene and clicking on the ââ¬Å"Locationâ⬠link on the PAH listing. The website lists the location of the gene to be at ââ¬Å"Chromosome 12: 103,232,104-103,311,381 reverse strand.â⬠(2) Though the website does not explicitly state where in chromosome 12 PAH is located, one can infer additional details from the provided images. For example, confusion can ensue from the fact that the indicated location in the image in the Ensembl website is on the long arm on q23.2, while previous sources have stated that it is located on q22-24.2. However, from the code in the location and the additional images, one can infer that these are the transcribed portions of the gene, two of which are illustrated in the site. Furthermore, one can see that the PAH gene is flanked by the genes insulin-like growth factor 1 (IGF1), or somatomedin C, and achaete-scute complex homolog 1 (ASCL1). To obtain the information, though, one needs to explore the interactive image (see Figure 2 below) and go to the individual pages of the neighbor genes. Figure 2 Detailed view of region near PAH (9) The NCBI website, however, while very extensive in details, and containing multiple transcripts pertaining to the PAH gene, can be somewhat confusing with regard to the Map Viewer. Going through the home page and directly searching for the desired gene results in a very large and confusing map, with the details of the gene and its neighboring gene beyond the page to right. For a beginner who is not quite sure what to look for, the NCBI Map Viewer can be very overwhelming. Focusing on the table and not the map, however, one can see that the PAH gene is located in Chromosome 12, in the long arm q22-q24.2; this information is under the heading ââ¬Å"Cytoâ⬠(for cytogenic) and stated as ââ¬Å"12q22-q24.2â⬠(10). Again, this might not be immediately clear to a beginner. Furthermore, the different master map options (Morbid, Gene_cyto, etc.) individually show different arrangements of the symbols, not all of which seem to be genes. Thus, it is very hard to decipher which genes are actually near PAH, although zooming in on the ââ¬Å"Genes on Sequenceâ⬠and ââ¬Å"Phenotypeâ⬠maps do reveal the proximity of IGF1 and ASCL1. In all, for a beginner, the Ensembl website proved to be much easier to use to answer the first question. The intron/exon structure of the PAH gene: It was very difficult to find an illustration of the structure of the PAH gene in the NCBI website. However, the information page for the gene stated that the gene spans 90 kb with the entire sequence and its adjacent regions a total of 171 kb. Furthermore, it states that the gene contains 13 exons, which consequently means that it has 12 introns (number of introns is one less than the number of exons) (1). After some searching, however, beginning with clicking the available links for PAH in the Map Viewer table, the link ââ¬Å"svâ⬠led to a page with the title ââ¬Å"Homo sapiens chromosome 12 genomic contig, GRCh37 reference primary assembly.â⬠Searching for the gene gives the following (zoomed-in and cropped) structure: à Figure 3 Structure of PAH gene (11) Though not obvious from the first glance, later we will see that the bottom sequence actually represents the structure of the PAH, with the vertical green lines representing the 13 exons. After further searching, the following (rotated) PAH structure showing the 13 exons and 12 introns can be found in the Map Viewer under ââ¬Å"ensRNAâ⬠: à Figure 4 Another illustration of the structure of PAH gene (11) Finding those, however, takes previous explicit knowledge and some work to track down the specific illustrations. In contrast, finding the number of exons and introns and an illustration of the structure of the PAH gene in the Ensembl website was very straightforward. The following illustration can be found in the same page as Figure 1: Figure 5 Ensembl illustration of PAH gene structure This strand, one of the transcripts available in the Ensembl page, clearly shows the 13 exons in a DNA sequence. Comparing this structure to Figures 3 and 4, the numbers and the arrangements of the exons and introns are exactly the same. However, relative to all the tedious searching needed to find the same answers in the NCBI website, the information needed for the question was instantly available from the Ensembl site, and the interface was very easy to understand. Common PAH mutations: Mutations in general can refer to abnormalities in function or structure of the concerned enzyme in the gene phenotype. As previously discussed, however, such as the causes of PKU and HPA, the human PAH gene has displayed allelic differences and pathogenic transformations throughout its structure. The common types of mutations and their occurrence according to a previous study are: missense mutations with 62% of the alleles, small or large deletions with 13%, splicing defects with 11%, silent polymorphisms with 6%, nonsense mutations with 5%, and insertions with 2% of the PAH alleles. (6) Table1 PAH mutation statistics Mutation Type: # of Mutation(s) Missense 336 Deletion 73 Splice 62 Silent 32 Nonsense 28 Insertion 10 Sil./Splice 3 Unknown 3 Total mutations: 547 Most reported Mutation (Association): p.R408W (214) Missense, as can be seen above, is the most common cause of mutation in the PAH gene, the molecular mechanism of this is the improper folding of the protein structure, causing aggregation or degradation. As mentioned earlier, the mutations of PAH are commonly caused by single changes in the amino acid. One of the missense mutations, for example, occurs in E1 nucleotide 1 with the change of ATG to GTG. However, there is also missense mutation in region E3 with sequence 187.000 in nucleotide 187; this is called ACC/CCC;CAC/AAC. The second most common type of mutation is deletion. An example of deletion mutation is in regions E2-12 with sequence 168.001 in nucleotide 168. This is called GAG/GAA;G/A and has been noted to have occurred in Palestinians Arabs. (2, 3, 12) à Other examples can be seen in Appendix (I). As mentioned earlier, there are three common variations of PKU: classical PKU, MHP, and non-PKU HPA. These variations which are basically different degrees of severity of the disorder are caused by the different kinds of mutations that cause varying PAH activity as well as allelic variations. The latter effect at the locus of the gene determines the metabolic phenotype of the enzyme deficiency. In general, however, the mutations in the PAH gene are localized in a main part of the gene instead of being randomly distributed, as they occur either within or without the active site. What is interesting to note is that the PAH gene in intron 12 involves the single base change of guanine to adenine in the canonical 5-prime splice donor site where the first identified PKU mutation occurred. (3) Two out of the 6 links given by the Gene Gateway page were no longer working, one was solely dedicated to SNP, one was a link to a database that had links to other databases, and the last two were already explored thoroughly in previous parts of this assignment. The data presented in this section were mostly from the entire site dedicated to PAH gene mutations, the Phenylalanine Hydoxylase Locus Knowledgebase (5). This site, also a database, was arrived at after searching through the Locus Specific Mutation Databases which in turn arrived at from Human Genome Variation Society: Variation Databases and Related Sites. While the OMIM site did give some details about previous studies related to PAH gene mutations, they were more of a history of the mutations and examples of the studies. Finding the needed information was difficult because one needed to go through link after link and website after website, sometimes even arriving at the same website numerous times through different pathwa ys and still not obtaining any results. The PAHdb was by far, the only site that showed any data regarding the common mutations. Single nucleotide polymorphisms (SNPs) of the PAH gene: To date, 1220 SNPs for the PAH gene have been discovered, although GeneCards (2) states only 1097 from the NCBI website. In general, the SNPs involve the changing of a single base, as shown in Appendices I and II. Examples are the three found on exon 3, each of which has a single change of base, name cytocine, thiamine, and adeninine(13). Examples of these PAH gene SNPs are the rs63749677, rs63749676, rs63581460 and rs63499960; some of these are tabulated in Appendix (II). These SNPs are not randomly distributed as out of the 13 exons, they are seen in exons 1-7 and 12. Searching the NCBI website, however, resulted in 55 entries of SNPs with the following format: rs79931499 [Homo sapiens] CAATCCTTTGGGTGTATGGGTCGTAG[C/G]GAACTGAGAAGGGCCGAGGTATTGT 12 The above entry, an example of the results from the query in the NCBI SNP website, shows essential information about the SNP as well as options one can view. Compared to the other related links, which did not yield any useful information other than linking back to this site, the NCBI site dedicated purely to SNPs was simple and the information was easy to retrieve. Due to the very large number of SNPs, however, it would be difficult to evaluate all of them. Designing PCR primers: The given instructions and the program given in the website were rather straightforward, so the designing of the primer was the easiest part of the activity. The mRNA sequence was easily downloadable and the program was user-friendly (14). Being able to design primers this way was very fast and easy. The resulting primers are in Appendix (III). References: 1. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/omim/612349 2. Hoeks M, den Heijer M, Janssen M. Adult issues in phenylketonuria. The Netherlands journal of medicine2009;67(1):2. 3. [21/09/09]; Available from: http://www.ensembl.org/index.html. 4. [26/08/10]; Available from: http://www.genecards.org/cgi-bin/carddisp.pl?gene=PAHsearch=pah#loc 5. [26/08/10]; Available from: http://www.pahdb.mcgill.ca. 6. Carter K, Byck S, Waters P, Richards B, Nowacki P, Laframboise R, et al. Mutation at the phenylalanine hydroxylase gene (PAH) and its use to document population genetic variation: the Quebec experience. European Journal of Human Genetics1998;6(1):61-70. 7.à [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=gndpart=phenylketonuria 8. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/bookshelf/br.fcgi?book=genepart=pku 9. [26/08/10]; Available from: http://www.ensembl.org/Homo_sapiens/Location/View?db=core;g=ENSG00000171759;r=12:103232104-103311381;t=ENST00000307000 10. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/mapview/maps.cgi?taxid=9606chr=12MAPS=pheno,morbid,genec,decode,ensrna,ensgenes,rnaRn,rnaMm,rnaHs,rnaGga,rnaBt,gbdna,rna,ugHs,genes-rcmd=focusfill=80query=uid(136508683,136446655,12845117,12579049,8990832,717234,698472,11088097,11049717,6481463,570698,568170,34586070,16320694,13572526,34590012,128619463,415205)QSTR=pah 11. [26/08/10]; Available from: http://www.ncbi.nlm.nih.gov/projects/sviewer/?id=NT_029419.12v=65375409..65454686 12. *Robin A Williams, 2 Cyril DS Mamotte,2 *John R Burnett1,3. Phenylketonuria: An Inborn Error of Phenylalanine Metabolism 13.à à à à à à à [updated 21/09/09]; Available from: http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=5053 14.à à à à à à à [21/09/09]; Available from: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi Appendices: Appendix (I) Examples 1. Systematic Name: c.1AG Region: E1 Reference (1st): Mutation Name: p.M1V Sequence: 0.000 JOHN SW, ROZEN R, LAFRAMBOISE R, LABERGE C, SCRIVER CR: Novel PKU mutation on haplotype 2 in French-Canadians. Am J Hum Genet 45:905-909, 1989 Other Name: ATG/GTG Length: 1 Nucleotide No.: 1 Rest. Site: -Xba I Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 2. Systematic Name: c.3GA Region: E1 EIKEN HG, KNAPPSKOG PM, APOLD J, SKJELKVÃâ¦LE L, BOMAN H: A de novo phenylketonuria mutation: ATG (Met) to ATA (Ile) in the start codon of the phenylalanine hydroxylase gene. Hum Mut 1:388-391, 1992 Mutation Name: p.M1I Sequence: 3.000 Other Name: ATG/ATA Length: 1 Nucleotide No.: 3 Rest. Site: -NspI Mutation Type: Missense Syst. Name gDNA: Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No 3. Systematic Name: c.117CG Region: E2 FORREST SM, DAHL HH, HOWELLS DW, DIANZANI I, COTTON RGH: Mutation detection in phenylketonuria by using chemical cleavage of mismatch: Importance of using probes from both normal and patient samples. Am J Hum Genet 49:175-183, 1991 Mutation Name: p.F39L Sequence: 117.000 Other Name: TTC/TTG Length: 1 Nucleotide No.: 117 Rest. Site: -MboII, +MaeIII Mutation Type: Missense Syst. Name gDNA: Erlandsen H, Pey AL, Gà ¡mez A, Pà ©rez B, Desviat LR, Aguado C, Koch R, Surendran S, Tyring S, Matalon R, Scriver CR, Ugarte M, Martà nez A, Stevens RC.: Correction of kinetic and stability defects by tetrahydrobiopterin in phenylketonuria patients with certain phenylalanine hydroxylase mutations. Date Entered: 1997-01-31 CpG/Fs/Pm: No/No/No Appendix (II) SNPs of the PAH gene Region Contig position mRNA pos dbSNP rs# cluster id Hetero- zygosity Function dbSNP allele Protein residue Codon pos Amino acid pos exon_12 26716405 1750 rs59326968 N.D. synonymous C Asn [N] 3 426 contig reference T Asn [N] 3 426 exon_7 26728783 1314 rs5030851 N.D. missense T Leu [L] 2 281 contig reference C Pro [P] 2 281 exon_6 26731200 1061 rs5030653 N.D. missense (22bp) [CIKPMLAN] 1 197 frame shift -/TGTATAAAACCCATGCTTGCTA 1 197 contig reference (22bp) [LYKTHACY] 1 197 26731262 1020 rs17852373 N.D. missense G Gly [G] 2 183 contig reference A Glu [E] 2 183 exon_3 26770856 671 rs5030842 N.D. missense C Pro [P] 1 67 contig reference T Ser [S] 1 67 contig reference A Ser [S] 3 36 exon_1 26793098 474 start codon 1 Appendix (III) Designed Primers Exon1 ENSE00001141448 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG PCR primer design: No mispriming library specified Using 1-based sequence positions OLIGOà à à à à à à à à à à à à à à à à à à à à à start à à len à à à tm à à à à à à gc% à à anyà à à 3à à à à à à seq LEFT PRIMERà à à à à à à à à 369à à 20à à 59.83à à 55.00à 6.00à 2.00 à à TCCTCCCTAGTGCGAGGTTA RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00à 3.00à 2.00 à à CAGAGAGTTTCCTGCCCAAG SEQUENCE SIZE: 533 INCLUDED REGION SIZE: 533 PRODUCT SIZE: 154, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 3.00 1 CAGCTGGGGGTAAGGGGGGCGGATTATTCATATAATTGTTATACCAGACGGTCGCAGGCT 61 TAGTCCAATTGCAGAGAACTCGCTTCCCAGGCTTCTGAGAGTCCCGGAAGTGCCTAAACC 121 TGTCTAATCGACGGGGCTTGGGTGGCCCGTCGCTCCCTGGCTTCTTCCCTTTACCCAGGG 181 CGGGCAGCGAAGTGGTGCCTCCTGCGTCCCCCACACCCTCCCTCAGCCCCTCCCCTCCGG 241 CCCGTCCTGGGCAGGTGACCTGGAGCATCCGGCAGGCTGCCCTGGCCTCCTGCGTCAGGA 301 CAACGCCCACGAGGGGCGTTACTGTGCGGAGATGCACCACGCAAGAGACACCCTTTGTAA 361 CTCTCTTCTCCTCCCTAGTGCGAGGTTAAAACCTTCAGCCCCACGTGCTGTTTGCAAACC 421 TGCCTGTACCTGAGGCCCTAAAAAGCCAGAGACCTCACTCCCGGGGAGCCAGCATGTCCA 481 CTGCGGTCCTGGAAAACCCAGGCTTGGGCAGGAAACTCTCTGACTTTGGACAG KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start à à len à à à tm à à à à à à gc% à à anyà à à à à 3à à à à à à à à à à à seq 1 LEFT PRIMERà à à à à à à à 339à à 20à à 59.77à à 50.00 à à 3.00 à à 1.00à à à à ACGCAAGAGACACCCTTTGT RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00 à à 3.00 à à 2.00 à à à à à CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 184, PAIR ANY COMPL: 6.00, PAIR 3 COMPL: 2.00 2 LEFT PRIMERà à à à à à à 318à à 20à à 59.32à à 55.00à 4.00à 2.00 GTTACTGTGCGGAGATGCAC RIGHT PRIMERà à à à à à 522à à 20à à 59.98à à 55.00à 3.00à 2.00 CAGAGAGTTTCCTGCCCAAG PRODUCT SIZE: 205, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 3 LEFT PRIMERà à à à à à à 157à à 20à à 60.07à à 55.00à 2.00à 0.00 CTGGCTTCTTCCCTTTACCC RIGHT PRIMERà à à à à à 337à à 20à à 59.32à à 55.00à 4.00à 3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 181, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMERà à à à à à à 156à à 20à à 60.07à à 55.00à 3.00à 0.00 CCTGGCTTCTTCCCTTTACC RIGHT PRIMERà à à à à à 337à à 20à à 59.32à à 55.00à 4.00à 3.00 GTGCATCTCCGCACAGTAAC PRODUCT SIZE: 182, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 2.00 Statistics conà à tooà à à inà à à inà à à à à à à à à noà à à tmà à à tmà highà highà à à à à à à high sidà manyà à tarà exclà à badà à à GCà à tooà à tooà à anyà à à 3à polyà à end eredà à à Nsà à getà à regà à GC% clampà à lowà high compl complà à à à Xà stabà à à ok Leftà à à 3637à à à à 0à à à à 0à à à à 0à à 162à à à à 0à à 419à 2558à à à à 0à à à à 2à à à 22à à à 73à à 401 Rightà à 3701à à à à 0à à à à 0à à à à 0à à 130à à à à 0à à 321à 2817à à à à 0à à à à 2à à à à 0à à à 78à à 353 Pair Stats: considered 140, unacceptable product size 129, high end compl 3, ok 8 primer3 release 1.1.4 KEYS (in order of precedence): left primer right primer ADDITIONAL OLIGOS start à à len à à à tm à à à à à à gc% à à anyà à à 3à à à à à à à à seq 1 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00 à à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 265à à 20à à 58.12à à 40.00à 3.00à 0.00 à à TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 247, PAIR ANY COMPL: 2.00, PAIR 3 COMPL: 0.00 2 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 260à à 22à à 60.05à à 40.91à 4.00à 0.00 à à GATGACCCCAAAAGATTTACCA PRODUCT SIZE: 242, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 3 LEFT PRIMERà à à à à à à à 45à à 20à à 60.39à à 50.00à 6.00à 1.00à à à AGCCATGGACAGAATGTGGT RIGHT PRIMERà à à à à à 265à à 20à à 58.12à à 40.00à 3.00à 0.00 à à TCAAAGATGACCCCAAAAGA PRODUCT SIZE: 221, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 4 LEFT PRIMERà à à à à à à à 19à à 20à à 60.21à à 50.00à 5.00à 2.00 à à à à GCAGTGCCCTCCAGAAAATA RIGHT PRIMERà à à à à à 258à à 20à à 57.92à à 40.00à 4.00à 0.00 à à TGACCCCAAAAGATTTACCA PRODUCT SIZE: 240, PAIR ANY COMPL: 4.00, PAIR 3 COMPL: 1.00 Statistics conà à tooà à à inà à à inà à à à à à à à à noà à à tmà à à tmà highà highà à à à à à à high sidà manyà à tarà exclà à badà à à GCà à tooà à tooà à anyà à à 3à polyà à end eredà à à Nsà à getà à regà à GC% clampà à lowà high compl complà à à à Xà stabà à à ok Leftà à à 7708à à à à 0à à à à 0à à à à 0à à 791à à à à 0à 4562à à 600à à à à 0à à à 14à à à à 0à à à 52à 1689 Rightà à 7734à à à à 0à à à à 0à à à à 0à 1269à à à à 0à 4609à à 311à à à à 0à à à à 6à à à à 0à à à 44à 1495 Pair Stats: considered 2222, unacceptable product size 2195, high end compl 6, ok 21 primer3 release 1.1.4
Sunday, March 15, 2020
Origins of the Kettlebell. Strength and Cardio Training
Origins of the Kettlebell. Strength and Cardio Training The kettlebell is a peculiar piece of gym equipment. While it looks like a cannonball with a looping handle protruding at the top, it canà easily be mistaken for an ironcast tea kettle on steroids. It also happens to be growing in popularity, allowing athletes and those just trying to stay in shape to perform a wide range of specialized strength-building exercises with kettlebells. Born in Russia Itââ¬â¢s hard to say who invented the kettlebell, though variations of the concept go as far back as Ancient Greece. Theres even a 315-pound kettlebell with the inscriptionà ââ¬Å"Bibon heaved up me above a head by one head on display at the Archaeological Museum of Olympia in Athens. The first mention of the term, however, shows up in a Russian dictionary published in 1704 as Girya, which translates to kettlebell in English. Kettlebell exercises were later popularized in the late 1800s by a Russian physician named Vladislav Kraevsky, considered by many to be the countrys founding father of Olympic weight training. After spending roughly a decade traveling around the world researching exercise techniques, he opened one of Russias first weight training facilities where kettlebells and barbells were introduced as a core part of a comprehensive fitness routine. By the early 1900s, Olympic weightlifters in Russia were using kettlebells to shore up weaker areas, while soldiers used them to improve their conditioning in preparation in combat. But it wasnt until 1981 that the government finally threw its weight behind the trend and mandated kettlebell training for all citizens as a way to boost overall health and productivity.à In 1985, the Soviet Unions first national championship kettlebell games were held in Lipetsk, Russia. In the United States, itââ¬â¢s only as recent as the beginning of the century that kettlebell has caught on, particularly in the last few years. A-list celebrities such as Matthew McConaughey, Jessica Biel, Sylvester Stallone, and Vanessa Hudgens have been known to utilize kettlebell workouts to strengthen and tone. Thereââ¬â¢s even an all-kettlebell gym located in Ontario, Canada, called the IronCore Kettlebell club. Kettlebells vs. Barbells What distinguishes a kettlebell workout from training with barbells is an emphasis on a wider range of movement that involves several muscle groups. Whereas barbells are generally used to directly target isolated muscle groups, such as the biceps, the kettlebellââ¬â¢s weight is away from the hand, allowing for swinging moves and other full body exercises. Case in point, hereââ¬â¢s a few kettlebell exercises aimed at cardiovascular and strength improvement: High Pull: Similar to a squat, the kettlebell is lifted from the floor and brought up toward the shoulder level with one hand while straightening out to a standing position and returning back to the floor. Alternating between both arms, this move hits the shoulders, arms, buttocks, and hamstrings.Lunge Press: Holding the kettlebell in front of the chest with both hands, lunge forward and lift the weight over your head. Alternating each leg, this allows you to target the shoulders, back, arms, abs, buttocks, and legs.à Russian Swing: Standing with knees slightly bent and feet apart, hold the kettlebell just below the groin with both hands and with both arms straight. Lowering and driving the hips back, thrust the hips forward and swing the weight forward up to shoulder level before letting the weight swing back down to the original position. This move targets the shoulders, back, hips, glutes, and legs.à à Additionally, kettlebell exercises burn more calories than conventional weightlifting exercises, up 20 calories a minute, according to a study by the American Council on Exercise (ACE). This is roughly the same amount of burn youd get from a rigorous cardio workout. Despite the benefits, the one drawback is that only select gyms carry them. So where can you go to find kettlebell equipment outside of obvious places like the IronCore gym? Fortunately, an increasing number of boutique gyms have them, along with kettlebell classes. Also, since theyre compact, portable and with many shops selling them for prices comparable to the cost of barbells, it might be worth it to just buy a set. Source Beltz, Nick M.S. ACE Sponsored Research Study: Kettlebells Kick Butt. Dustin Erbes, M.S., John P. Porcari, et al., American Council on Exercise, April 2013.
Thursday, February 27, 2020
Early Childhood Learning Essay Example | Topics and Well Written Essays - 1500 words
Early Childhood Learning - Essay Example The third part will summarize some of the commentaries on the controversy and finally the conclusion will discuss which if any view is correct, and the importance of the controversy at hand. In an experiment conducted by Booth and Waxman (2002), a group of three years old children were subject to the same objects which were separated into two groups, either as animate objects or artifacts. When some of the objects with eyes on them, which are strong perceptual cues to animacy, and the objects were presented as artifacts, the children characterized them as artifacts. This shows that even in the face of strong perceptual gestures, conceptual information still aids the process of word learning in childhood, a view that contradicts the Attentional Learning Account view. Something which sparked a number of responses and different interpretations to this experiment but which face certain difficulties that further support the view that conceptual information does have a role in early word learning. First it was noted that both conc... s, in what sense then is perceptual information immune to conceptual information This simply means that if two factors affect the same variable, the only way one of the factors can be immune to the other is if one of them does not have an effect at all on the variable, something that the experiment mentioned above excludes. Second it was claimed by the Attentional Learning Account that perceptual information contributes directly to word learning unaided by any conceptual information; the experiment shows however that perceptual learning can be aided by conceptual information in a way that can change the outcome of the experiment. A special case of these two different views will be taken into account; namely the disagreement about the shape bias. The controversy over the role of conceptual learning in early word learning for children has initiated the shape bias controversy; briefly stated it is an implication of the two views outlined above. On the one hand the proponents of the Attentional Learning Account claim that shape bias does not emerge until infants are able to distinguish at least 50 nouns which is in line with the claim they support that conceptual knowledge is only available much later. On the other hand Booth and Waxman have shown with an experiment they conducted with 18 to 22 months old children with vocabulary that does not exceed 18 nouns that these children have extended their uses of words on the basis of shape. This experiment thus interpreted challenges the whole of the Attentional Learning Account proponents. In a paper in the Developmental Science journal, Booth and Waxman have shown experiments in support of the Attentional Learning Account view and have tried to show that they can be interpreted in a way that does not do any harm to their view
Tuesday, February 11, 2020
Interest Rates Essay Example | Topics and Well Written Essays - 500 words
Interest Rates - Essay Example Thirdly and lastly, the lender has to be compensated for the decrease in value of the money due to inflation, for example a dozen eggs might cost 100rs today and after a year they might cost 110rs, so if I have loaned any one 100rs I will want 110rs back because that is what 100rs is NOW worth or that is the equivalent value. There are basically two theories that explain how interest rates are decided upon, one is the 'Loanable Funds Theory' also known as the classical theory and the other one is 'Keynesian Theory' also known as the liquidity preference theory. The loanable funds theory is the older one of the two theories and according to this theory the interest rates are determined by the demand for loanable funds by firms and the supply of these funds by the banking and other investment funds, it suggests that interest rates are determined in the same way as demand for other goods and services is determined i.e. by finding the equilibrium position of the demand and supply of the relative product.
Friday, January 31, 2020
Costs and benefits of the migration Essay Example for Free
Costs and benefits of the migration Essay The costs are highly experienced in the developing countries than the developed countries. The migration of the practitioners leaves the medical system being completely inadequate to carry out its mandate on top of the many other problems such institutions already faces. Therefore, the first major cost faced due to the migration is the lack of the institutions to provide the required medical care to the citizens. This becomes worse when it is not possible for the institutions to replace the manpower lost. This means that those left behind to work in the institutions will have to be overworked while still being paid the little amount they used to receive. The more the employees are strained, the more they are pushed to look for better working conditions elsewhere making the situation worse (Stewart, Clark Clark, para 11). The other cost comes in form of the investment that has been used in the training of the practitioners who migrate. Most of the developing countries subsidize or entirely sponsors the training of these practitioners. It thus implies that the investment the government puts in such personnel is lost when they migrate to the developed countries. The major benefits that this migration brings can be categorized into the remittances that the practitioners send to their home countries, and the skills they get due to the exposure. The amount sent home is more important in improving the economic life of those left behind and the nation as a whole. This remittance plays a significant role in the practitionerââ¬â¢s country of originââ¬â¢s economy in form of foreign funds. This has made some countries like the Philippines to train more nurses and sent them to practice in developed countries and thus contribute to the Gross National Product growth (Tujan, para 15). Most of the developing countries do not have enough medical facilities. Therefore, when the practitioners moves temporarily to the developed countries, they get to be exposed at high levels of technology which makes them have improved skills that will plays a significant role in developing the medical system in their home country when they go back. This implies that the country of origin might save a lot in terms of what could have been spent in specialized training or higher education for the practitioners. The major problem with this however is that, many of the practitioners do not return home, and when they do, they have retired hence not productive. In the developed countries In the country of origin, the migration causes a lot of costs than the benefits. However, on the receiving countries, the benefits accrued are higher than the costs incurred. The issue of recruitment within any organization is usually a costly affair. Recruitment of the immigrants is thus more costly than local recruitment. This can force the organization and the government to pass the extra costs to the consumers increasing the cost of living in the society. The cost can also be experienced in the course of resettlement of the immigrants (Stilwell et al, para 7). There are some instances in which the immigrants are willing to take up some policies set by a government more than the local practitioners. For instance, working in form of contracts or part-time. Many of the locals do not agree with this, hence when the immigrants seem to agree with such a policy, they are usually recruited in favor of the locals, and this will generally affect the wages of the local practitioners, which will further go down affecting the tax bracket of the receiving country. In a case where the locals see that they are competing with the immigrants, there can be low morale and reduced commitment in the working. This might be looked at in the micro economic level as affecting only the firm; however, the macro-economic effect has to be put in consideration. The most important benefit of the professionals inflow from the developing to the developed countries is experienced when there is no shortage of the practitioners. This means there shall be improved provision of health care services. The local practitioners in developed countries mostly would need to be paid higher remunerations as compared to the immigrants. Therefore, if the immigrants are employed, it means they shall provide medication at a cheaper rate which will go down reducing the cost that could be passed to the consumer. On the other hand, the government will benefit from the taxes that will be collected from the foreign practitioners (Crush, pp 7). Conclusion Both countries have some benefits and costs they get when the professionals migrate. However, as argued, most of developing countries get more costs than the benefits from these acts. It is thus important that the concerned stakeholders should come up with policies that would see ethical migration between the receiving and sending country so that no country benefits at the expense of another. Work Cited Crush J. The Global Raiders: Nationalism, Globalization and the South African Brain Drain, 2002. Journal of International Affairs, Vol. 56, Issue 1, pp 4-7. Kapur D Mchale J. Should a Cosmopolitan Worry about the Brain Drain? 2006, Journal of Ethics International Affairs, Vol. 20, Issue 3, pp 11-15. Stewart J, Clark D Clark P F. Migration and Recruitment of Healthcare Professionals: Causes, Consequences and Policy Responses, 2007. Retrieved on October 28, 2008 from http://www. focus-migration. de/The_Migration_and_Re. 2496. 0. html? L=1. Stilwell B, Diallo K, Zurn P, Dal Poz M R, Adams O Buchan J. Developing evidence-based ethical policies on the migration of health workers: conceptual and practical challenges, 2003. Journal of Human Resources for Health, Retrieved on October 28, 2008 from http://www. human-resources-health. com/content/1/1/8. Tujan A. Health Professionals Migration and its Impact on the Philippines, Journal of Asia Pacific Research Network, 2002. vol. 6, Issue 1. Retrieved on October 28, 2008 from http://www. aprnet. org/index. php? a=showc=Volume%206%20March%202002t=journalsi=5.
Thursday, January 23, 2020
racismhf Free Huckleberry Finn Essays: Prejudice and Racism :: Adventures Huckleberry Huck Finn Essays
Adventures of Huckleberry Finn:à Racismà à à à à à à The twentieth century has come to an amazing finale.à Racism, ethnic prejudice and hate are on the decline.à Perhaps some of these changes can be attributed to the novel, The Adventures of Huckleberry Finn, in which Mark Twain addresses the issues of racism and slavery. He writes in a humorous, almost childish way, yet the themes are clear and poignant.à Twain utilizes Huck Finn and Jim as the ideal characters because they are the ones at the end of the novel who realize slavery is wrong.à Mark Twain establishes the ideals by portraying them through the protagonists, Huck and Jim and criticizes the failure to live up to them by portraying them through the antagonists, Miss Watson. à à à à à à à à Prejudice can be observed throughout the novel by the way the other characters treat Huck.à Twain portrays Huck as an average boy of his time, mischievous, adventurous and funny.à The society Huck lives in labels him "uncivilized" because he has an abusive, drunk father.à "By and by pap got too handy with his hick'ry and I couldn't stand it.à I was all over with welts" (Twain page #).à Here the reader can observe the ultimate failure of an uncivilized person.à Pap is an alcoholic, a dead beat and a racist.à Nevertheless, society also considered Huckà "uncivilized" because he did not wear shoes did not always attend school and he smoked.à Society criticized Huck as uncivilized due to physical appearance when really Huck turned out to be more civilized than any other character in the novel because he learns how to respect Jim.à Through the ironic criticism of society trying to civilize Huck, Huck teaches us a lesson on bein g civilized.à à à à à à à à à In the novel, Jim runs away from his slave owner, Miss Watson.à By doing a thing like that Jim could have been killed or beat.à The people of Jimââ¬â¢s society would not have even listened to him or even considered his reason.à "Well, you see, it 'uz dis way.à Ole missus-dat's Miss Watson- she pecks on me all de time, en treats me pooty rough, but she alwuz said she wouln' sell me down to Orleans. ... but she could git eight hund'd dollars for me" (Twain page #).à Twain wanted to show, through Jim, just how cruel people were and how those feelings were condoned by society.à Twain also shows the ideal of freedom through Jim and the failure to live up to that freedom when Miss Watson sells him.
Wednesday, January 15, 2020
Maxine Tynesââ¬â¢ poem ââ¬ÅReach out and Touchââ¬Â Essay
With Maxine Tynesââ¬â¢ poem Reach out and Touch, the title suggests that the poem literally is about a person reaching out and touching objects or people. Tynes suggests that the more mature generation should reach out and help others more often, and maybe touching someoneââ¬â¢s heart should be all worth it. The first 6 lines of Tynesââ¬â¢ poem, describes how the curiosity of a child. Line number 6 ââ¬Å"to see if it comes offâ⬠proves that the childââ¬â¢s intentions were purely curiosity. The use of ââ¬Å"electricâ⬠in line 3 was a very descriptive and vivid word to describe the poetââ¬â¢s bouncing curls. The author used these specific worlds and quotes to tell us that we should learn the innocents of a child and reach out to learn about the people around you. Without the ââ¬Å"reaching out and touchingâ⬠(2 & 3) part, the child wouldnââ¬â¢t have known that the personââ¬â¢s curly hair was electrifying (great curls). From lines 7 to 11, the mother, fear of bothering the person sitting in front of them, slapped the childââ¬â¢s hands away. With line 9 ââ¬Å"hush-up of your questionsâ⬠the poet is trying to make an analogy, as if ââ¬Å"slapping hands awayâ⬠(8) is what adults usually do. They donââ¬â¢t want their children to meddle into other peopleââ¬â¢s business, and in order to do that, we must not reach out to others. ââ¬Å"What if reaching out in turn could cause the children painâ⬠, is usually what the parents are thinking about. But children are too naà ¯ve to think that way. In line 11 ââ¬Å"why it doesnââ¬â¢t come offâ⬠proves this innocence. The remaining lines of the poem started out with poetââ¬â¢s attitude shifting towards sympathetic/empathetic, when they were playful and unaware of the characters to begin with. The shift starts on line 13 with the word ââ¬Å"but..â⬠which indicated the child was upset from not able to cure their curiosity or the poet was trying to suggest was that the child was upset from not letting their caring personality portray through. ââ¬Å"..in the fear that mother love wraps you inâ⬠is when the poet uses personification to show us that though mother love helps us grow, reaching out amongst friends is also a good thing. The title Reach out and Touch has a meaning beyond the literal. It is about reaching out to those of need and touch their hearts. With such a shortà poem, Maxine Tynes was able to effectively illustrate the importance of reaching out and touching lives of other people. Whether it is a lovable hug or just a word of friendly advice, this type of reaching out could be the key to a better world. The message the poet was trying to portray was to tell readers that socialize with an open-heart, and you will be amazed how someoneââ¬â¢s actions can touch your heart. By using subtle words of play, for example words like ââ¬Å"magic,â⬠ââ¬Å"warm,â⬠and ââ¬Å"okay,â⬠Maxine Tynes was able to portray just that.
Subscribe to:
Posts (Atom)